Acetylation of histone H3prevents resistance development caused by chronic mTOR inhibition in renal cell carcinoma cells
Eva Juengel,Anna Dauselt,Jasmina Makarevic
´,Christoph Wiesner,Igor Tsaur,Georg Bartsch,Axel Haferkamp 1,Roman A.Blaheta
⇑,1
Department of Urology,Johann Wolfgang Goethe-University,Frankfurt am Main,Germany
a r t i c l e i n f o Article history:
Received 20February 2012
Received in revised form 30April 2012Accepted 2May 2012
Keywords:
Renal cell carcinoma HDAC RAD001
Resistance development Histone H3acetylation
a b s t r a c t
Chronic mTOR inhibition may induce resistance development in renal cell carcinoma (RCC).We analyzed whether long-term exposure of RCC cells to the mTOR-inhibitor RAD001evokes resistance and whether additional targeting histone deacetylases (HDAC)by valproic acid (VPA)overcomes RAD001resistance.It is demonstrated that responsiveness to either drug alone is lost over time,evidenced by increased cell growth,proliferation and de-differentiation.However,drug sensitivity was conserved when RAD001and VPA were applied in concert.Molecular analysis particularly reveal
ed strong re-activation of Akt under chronic RAD001or diminished histone H3acetylation under chronic VPA single drug exposure.Combined drug application did not inactivate Akt but rather resulted in H3acetylation remaining high while RCC cell growth was still reduced.siRNA experiments revealed that histone H3acetylation is responsible for preserving drug sensitivity in RCCs.
Ó2012Elsevier Ireland Ltd.All rights reserved.
1.Introduction
Metastatic renal cell carcinoma (RCC)is associated with a bleak prognosis.It is generally unresponsive to cytotoxic,hormonal and radiation adjuvant therapies,and systemic treatment with inter-leukin-2or interferon alpha (IFNa)provides clinical benefit only to a small number of patients.During the last years,increased understanding of the molecular pathophysiology of RCC has led to development of several targeted agents.Since aberrant activa-tion of the Akt-mammalian target of rapamycin (mTOR)signaling axis has been correlated to RCC growth and dissemination,efforts have been exerted to apply a series of novel compounds capable of inhibiting mTOR and PI3K/Akt upstream signaling.Two of these have achieved clinical importance,the intravenous agent temsirol-imus and the oral drug RAD001(everolimus).Temsirolimus was approved
by the United States Food and Drug Administration (FDA)and by the European Medicines Agency (EMA)in 2007for the first-line treatment of RCC patients with poor-prognosis.Two years later,RAD001was recommended by the FDA and EMA for pa-tients with advanced progressive RCC or for patients with failed VEGF-targeted therapy [1].
Since the introduction of mTOR inhibitors,the progression-free survival of RCC patients has been significantly improved in both first and second-line treatment strategies [2].However,such treat-ment rarely yields complete response and is not curative.In fact,the median overall survival (OS)under temsirolimus has only been extended by 3months,and the combination therapy of temsiroli-mus with IFNa has not prolonged the median OS at all,compared to IFNa treatment alone [3].The final analysis of the Renal Cell can-cer treatment with Oral RAD001given Daily (RECORD)-1study also showed no significant difference in the median OS time for pa-tients treated with RAD001or placebo [4].
The reason for the time-limited therapeutic response is not clear.It has been argued that the tumor may adapt to prolonged blockade of the mTOR axis and escape from the drug mediated growth control [5].However,this is speculative and no data are available dealing with this issue [5].The present investigation eval-uates whether RCC cells over time become refractory to RAD001treatmen
t and analyzes the molecular background behind this phenomenon.Furthermore,whether the additional blockade of histone deacetylases (HDAC)may prevent resistance development induced by chronic RAD001exposure was also investigated.The reasoning behind down-regulating HDAC is based on earlier re-ports which have demonstrated that targeting HDAC may re-sensitize tumor cells to cytotoxic drug treatment [6,7].Based on an in vitro RCC cell culture model,evidence is provided here that long-term application of RAD001for 12weeks results in distinct drug non-responsiveness.The drug resistance is accompanied by
0304-3835/$-see front matter Ó2012Elsevier Ireland Ltd.All rights reserved./10.1016/j.canlet.2012.05.003
⇑Corresponding author.Address:Department of Urology,Goethe-University,
Interdisciplinary Science Building,Building 25,Room 204,Theodor-Stern-Kai 7,D-60590Frankfurt am Main,Germany.Tel.:+496963017109;fax:+496963017108.
E-mail address:Blaheta@em.uni-frankfurt.de (R.A.Blaheta).1
Contributed equally as senior authors.
specific alterations of cell signaling and cell cycle regulating pro-teins,compared to RCC cells treated with the compound for a short period of2weeks.Simultaneous targeting of mTOR and HDAC pre-vented the drug resistance in RCC cells,presumably by maintaining
a consistently high level of histone H3acetylation.
2.Materials and methods
2.1.Cell culture
Kidney carcinoma Caki-1cells were purchased from LGC Promochem(Wesel, Germany).The tumor cells were grown and subcultured in RPMI1640medium (Seromed,Berlin,Germany)supplemented with10%FCS,100IU/ml penicillin and 100l g/ml streptomycin at37°C in a humidified,5%CO2incubator.
2.2.Drugs
RAD001(provided by Novartis Pharma AG,Basel,Switzerland)was dissolved in DMSO as10mM stock solution and stored as aliquots atÀ20°C.Prior to the exper-iments,RAD001was diluted in cell culture medium to afinal concentration of1or 5nM[8].VPA(gift from G.L.Pharma GmbH,Lannach,Austria)was used at afinal concentration of0.5or1mM[9].Caki-1cells were treated twice a week,either with RAD00
1or with VPA,or with both together.The treatment procedure lasted for2 versus12weeks,after which the cell cultures were subjected to the in vitro assays listed below.Control cell cultures remained untreated.The2weeks application pro-tocol was carried out to resemble early effects of drug umor cells are still sensitive to RAD001.The12weeks application protocol was done to reflect chronic drug treatment over a longer period of time,when tumor cells begin to ac-quire drug non-responsiveness.Comparison of chronic and short treatment allows the detection of resistance specific modifications of the tumor cell biology,along with the identification of those molecules which have been altered during therapy. To exclude toxic effects of the compounds,cell viability was determined by trypan blue(Gibco/Invitrogen).Cells treated for2weeks are designated‘‘Short-term’’,cells treated for12weeks are designated‘‘Long-term’’in thefigures.
2.3.Apoptosis
For apoptosis detection the expression of Annexin V/propidium iodide(PI)was evaluated using the Annexin V-FITC Apoptosis Detection kit(BD Pharmingen, Heidelberg,Germany).Tumor cells were washed twice with PBS,and then incu-bated with5l l of Annexin V-FITC and5l l of PI in the dark for15min at RT.Cells were analyzed on a FACScalibur(BD Biosciences,Heidelberg,Germany).The per-centage of apoptotic cells(early and late)in each quadrant was calculated using CellQuest softwa
re(BD Biosciences).
2.4.Measurement of tumor cell growth and proliferation
Cell growth was assessed using the3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide(MTT)dye reduction assay(Roche Diagnostics,Penzberg,Ger-many).Caki-1cells(50l l,1Â105cells/ml)were seeded onto96-well tissue culture plates.After24,48and72h,10l l MTT(0.5mg/ml)was added for an additional4h. Thereafter,cells were lysed in a buffer containing10%SDS in0.01M HCl.The plates were incubated overnight at37°C,5%CO2.Absorbance at550nm was determined for each well using a microplate ELISA reader.Each experiment was done in tripli-cate.After subtracting background absorbance,results were expressed as mean cell number.clone
Cell proliferation was measured using a BrdU cell proliferation enzyme-linked immunosorbent assay(ELISA)kit(Calbiochem/Merck Biosciences,Darmstadt, Germany).Caki-1cells,seeded onto96-well microtitre plates,were incubated with 20l l BrdU-labeling solution per well for8h,fixed and detected using anti-BrdU mAb according to the manufacturer’s instructions.Absorbance was measured at 450nm.
2.5.Clonogenic assay
Caki-1cells were transferred to6-well plates at500cells per well.Following 10days incubation,colonies werefixed and counted.Clones of at least50cells were counted as one colony.
2.6.Cell cycle analysis
Cell cycle analysis was carried out using Caki-1cultures grown to subconfluen-cy.Tumor cell populations were stained with propidium iodide,using a Cycle TEST PLUS DNA Reagent Kit(Becton Dickinson)and then subjected toflow cytometry with a FACScanflow cytometer(Becton Dickinson).10,000events were collected from each sample.Data acquisition was carried out using Cell-Quest software and cell cycle distribution was calculated using the ModFit software(Becton Dickinson). The number of gated cells in G1,G2/M or S-phase was presented as%.
2.7.Western blot analysis
To explore cell cycle regulating proteins in Caki-1cells,tumor cell lysates were applied to a7%polyacrylamide gel and electrophoresed for90min at100V.The protein was then transferred to nitrocellulose membranes(1h,100V).After block-ing with non-fat dry milk for1h,the membranes were incubated overnight with monoclonal antibodies directed against cell cycle proteins:Cdk1(IgG1,clone1), cdk2(IgG2a,clone55),cdk4(IgG1,clone97),cyclin A(IgG1,clone25),cyclin
B (IgG1,clone18),cyclin D1(IgG1,clone G124–326),cyclin D3(IgG2b,clone1), p19(IgG1,clone52/p19),p21(IgG1,clone2G12),p27(IgG1,clone57;all:BD Bio-sciences).HRP-conjugated goat-anti-mouse IgG(Upstate Biotechnology,Lake Pla-cid,NY,USA;dilution1:5.000)served as the secondary antibody.The membranes were briefly incubated with ECL detection reagent(ECL™,Amersham/GE Health-care,München,Germany)to visualize the proteins and then analyzed by the Fusion FX7system(Peqlab,Erlangen,Germany).b-actin(1:1.000;Sigma,Taufenkirchen, Germany)served as the internal control.
To explore target specificity of RAD001and VPA,mTOR signaling and histone acetylation were also evaluated.The following monoclonal antibodies were used: Akt(IgG1,clone55),phospho Akt(pAkt;IgG1,clone104A282),p70S6k(IgG,clone 49D7),phospho p70S6k(pp70S6k;IgG,clone108D2;all:New England Biolabs, Frankfurt,Germany).To investigate histone acetylation,cell lysates were marked with anti-histone H3(IgG,clone Y173),anti-acetylated H3(IgG,clone Y28,dilution 1:500),anti-histone H4(polyclonal IgG)and anti-acetylated H4(Lys8,polyclonal IgG,dilution1:500;all from Biomol GmbH,Hamburg,Germany).
2.8.Flow cytometry
To evaluate the differentiation status of Caki-1cells,vimentin,alpha-smooth muscle actin(a-SMA),cytokeratin(CK)18,E-cadherin and N-cadherin expression were analyzed.Tumor cells were detached from the cultureflasks by accutase (PAA Laboratories GmbH,Pasching,Austria),washed in blocking solution(PBS, 0.5%BSA)andfixed with4%formaldehyde(Carl Roth GmbH&Co.,Karlsruhe, Germany).To allow intracellular staining,cells were then permeabilized using a permeabilization buffer(Fix&PermÒPermeabilization Medium;ADG Bio Research GmbH,Kaumberg,Austria)and subsequently incubated for60min at4C with phy-coerythrin(PE)-or FITC-conjugated monoclonal antibodies:anti-vimentin-FITC (mouse IgG1,clone V9;eBioscience,Frankfurt,Germany),anti-a-SMA-FITC(mouse IgG2a,clone1A4;Sigma–Aldrich,Steinheim,Germany),anti-CK18-FITC(mouse IgG1,clone DC-10;Exbio,Praha,Czech Republic),anti-E-cadherin-PE(mouse IgG2b, clone180224;R&D Systems,Wiesbaden,Germany)and anti-N-cadherin-PE(mouse IgG2a,clone401408;R&D Systems).Fluorescence intensity was then measured using a FACscan(Becton Dickinson;FL-2H(log)channel histogram analysis; 1Â104cells/scan)and expressed as meanfluorescence units.A mouse IgG1-FITC (P3.6.2.8.1;eBioscience)or IgG2a-PE(20102;R&D Systems)was used as an isotype control.
2.9.Immunohistochemistry
Caki-1cells were transferred to culture slides and allowed to grow to subconfl-uency.They were thenfixed with methanol/aceton(1:1,À20°C)and washed in blocking solution(PBS,0.5%BSA).The primary antibodies used were anti-E-cadherin(mouse IgG2a,clone36;BD Biosciences)or anti-N-cadherin(mouse IgG1,clone32;BD Biosciences).After60min incubation,the secondary antibody (N-HistofineÒSimple Stain Rat MAX PO(M);Nichirei Biosciences Inc.,Tokio,Japan) was added for30min.Subsequent to a further washing procedure,cells were stained with the substrate for peroxidase,3-amino-9-ethylcarbazole(AEC)(Large Volume AEC Substrate System;Thermo Scientific,Schwerte,Germany).Slides were visualized by a Zeiss AxioObserver Z1microscope and analyzed by the Axiovision software.
2.10.HDAC1and HDAC2knock down
Caki-1cells(3Â105/6-well)were transfected with small interfering RNA (siRNA)directed against HDAC1(gene ID:3065,target sequence:CACCCGGAGGAA AGTCTGTTA;Qiagen,Hilden,Germany)or HDAC2(gene ID:3066,target sequence: TCCCAATGAGTTGCCATATAA;Qiagen),with a siRNA/transfection reagent(HiPerFect Transfection Reagent;Qiagen)ratio of1:6.Non-treated cells and cells treated with 5nM control siRNA(All stars negative control siRNA;Qiagen)served as the con-trols.Subsequently,tumor cell growth was analyzed by the MTT assay as indicated above.
84 E.Juengel et al./Cancer Letters324(2012)83–90
2.11.Statistics
All experiments were performed 3–6times.Statistical significance was deter-mined with the Wilcoxon–Mann–Whitney-U -test.Differences were considered sta-tistically significant at a p value less than 0.05.
3.Results
3.1.Modulation of cell growth and apoptosis
In initial studies,Caki-1cells were exposed to VPA (0.5or 1mM)or RAD001(1or 5nM)or the VPA–RAD001combination (1mM–1nM or 0.5mM–5nM schedule)and cell growth was eval-uated.Chronic treatment with either agent alone for 2weeks re-sulted in a significant reduction of the cell number,compared to untreated controls (VPA 1mM >VPA 0.5mM;RAD0015nM >RAD0011nM)(Fig.1A,‘‘short-term’’).Tumor cells lost their sensitivity to RAD001or VPA after 12weeks,because growth activ-ity was no longer diminished by each drug alone,regardless of the concentration used (Fig.1A,‘‘long-term’’).Responsiveness was conserved,however,when Caki-1cells were exposed to the
RAD001-VPA combination and tumor cell growth was diminished compared to untreated cells (Fig.1A,‘‘long-term’’).
Since this phenomenon was similar in the 1mM VPA–1nM RAD001and the 0.5mM VPA–5nM RAD001protocol,further investigation was restricted to the 0.5mM VPA–5nM RAD001schedule.In doing so,0.5mM VPA,5nM RAD001or the drug com-bination did not alter apoptosis after 2weeks (data not shown).However,apoptotic events (both early and late)significantly de-creased in cell cultures treated with VPA or RAD001for 12weeks,whereas down-regulation of apoptosis was prevented in the pres-ence of both agents (Fig.1B).3.2.Cell cycle analysis
RAD001,given for 2weeks,significantly elevated the amount of Caki-1cells in the G0/G1phase,accompanied by a significant reduction of cells in the G2/M and S-phase.This effect was also in-duced by VPA,although to a lesser extent than RAD001(Fig.1C,‘‘short-term’’).A different response was seen after 12weeks.VPA and RAD001applied separately did not reduce the amount of S-phase and G2/M-phase cells.Simultaneously,the amount of G0/G1cells did not increase,compared to the controls.In contrast,the combined treatment altered cell cycle progression,as evi-denced by significantly diminished G2/M and S-phase cells,com-pared to the controls (Fig.1C,‘‘long-term’’).3.3.Cell proliferation and clonal growth
The BrdU assay demonstrated a significant loss of cell prolifer-ation in the short-term phase after drug administration (2weeks)with the drug combination being superior to the single drug treat-ment (Fig.2A,upper left).However,tumor cells became resistant
Control RAD V P A
RAD/V P A
11.81
17.84
69.81
5.62
10.22
83.73
9.18
13.84
76.44
11.74
19.13
68.60
B
growth analysis of Caki-1cells treated short-term or long-term with RAD001and VPA,alone or in combination (RAD/VPA).(A)Dose response analysis.with different concentrations of RAD001and/or VPA and cell growth analyzed by the MTT dye reduction assay.Controls presentative from six separate experiments.ÃIndicates significant difference to controls.(B)Analysis of early and late apoptosis of Caki-1cells treated and 0.5mM VPA by the Annexin V-FITC Apoptosis Detection assay.The upper right quadrant demonstrates percentage of cells in late apoptosis,percentage of cells in early apoptosis.The lower left quadrant shows percentage of vital cells (SD intra-assay <10%).The figure shows one representative experiments.(C)Cell cycle analysis
of Caki-1cells treated short-term or long-term with 5nM RAD001and 0.5mM VPA.Subconfluent cell cultures cytometry and cell cycling evaluated by the Cycle TEST PLUS DNA Reagent Kit.The cell population at each specific checkpoint is expressed as percentage E.Juengel et al./Cancer Letters 324(2012)83–90
85
to both agents after 12weeks in the single drug protocol.According to the cell growth assay,the VPA–RAD001combination still blocked proliferation in a significant manner (Fig.2A,upper right).
Both compounds,VPA and RAD001,applied alone or in combi-nation,efficiently reduced the number of tumor clones in the 2week setting (Fig.2A,down left).In contrast,12weeks after experimental start the outgrowth of tumor clones was only altered when both drugs were added in combination.Single drug adminis-tration left cell clone development unchanged (Fig.2A,down right).
3.4.Cell cycle regulating proteins
Modifications of the cell cycle controlling machinery were investigated in the tumor cells chronically treated for a short (2week)versus long (12week)period.Based on the 2week proto-col,RAD001dimini
shed the expression level of cdk1and cyclin D3and enhanced p19and p27,compared to the control cell cultures (Fig.2B).p21was marginally expressed in untreated Caki-1cells and slightly elevated by RAD001.Cdk2was moderately up-regu-lated and no changes were evoked on cdk4and cyclins A,B and D1.A different profile was seen in Caki-1cells following the 12week treatment.Cdk1was still reduced,however,cdk2,cdk4and cyclin D1were now strongly up-regulated.No alterations were induced on cyclin D3and p19expression.p27was still found to be over-expressed,whereas p21was diminished,compared to the controls (Fig.2B).VPA slightly elevated cyclin D1,strongly en-hanced p19and distinctly reduced cyclin D3in the early phase of tumor treatment.A different cell response was triggered after 12weeks,reflected cyclin A and D3being now elevated over con-trol levels.No effect was induced on p19and the amount of p27was even diminished in treated versus non-treated cells.
Combined drug application caused an additive effect on p19up-regulation after 2weeks,which however was lost after 12weeks.p27was reduced after 12weeks exclusively,and cdk1was dimin-ished in the early,but not in the late phase of drug treatment.On the other hand,cyclins D1and D3were enhanced over the total
observation period,whereby this effect was stronger after 12weeks than after 2weeks (Fig.2B).3.5.Dif
ferentiation induction
Growth and proliferative activity depends on the differentiation status of the tumor cells.Flow cytometry demonstrated that VPA diminished a -SMA and CK18expression during the early phase of tumor cell treatment,whereas RAD001did not alter a -SMA but led to a considerable up-regulation of CK18(Fig.3,‘‘short-term’’).Vimentin was not modified by a 2week exposure to any of the drugs,but increased after a 12week exposure in the order RAD001>VPA >RAD001–VPA.The same effect was seen on a -SMA (Fig.3,long-term).CK18remained high under RAD001,and the RAD001–VPA combination was not able to counteract this process.
The N/E-cadherin ratio became significantly elevated after chronic administration of VAP or RAD001over 12weeks (Fig.4A).However,incubation with the RAD001–VPA combination stabilized the N/E-cadherin content which was similar to the con-trol value.Immunohistochemical analyses were carried out to sub-stantiate these findings.No differences in N-or E-cadherin expression were detected between treated and non-treated Caki-1cells after 2weeks (data not shown).However,distinct modifications were recorded after 12weeks.Control tumor cul-tures were characterized by N-cadherin expression along the cell surface as well as within the cytoplasm (Fig.4B).Membranous N-cadherin distribution was visualized after long-term RAD001treatment.Typic
ally,N-cadherin also accumulated directly below the plasma membrane (Fig.4B,arrows).This phenomenon was also induced by VPA,although to a lesser extent.A weaker membra-nous staining intensity was detected in those cells exposed to the RAD001-VPA combination,and N-cadherin accumulated around the cell nucleus.
E-cadherin was stained marginally with a diffuse expression pattern.The E-cadherin distribution was not modified by the single drug treatment.A few cells reacted strongly positive against anti-E-cadherin antibodies following 12weeks exposure to the VPA–RAD001combination (Fig.4B).
Short-term Long-term
cyclin D1 cyclin D3 C o n t r o l
R a d
V P A
R A D /V P A
C o n t r o l
R a d
V P A
R A D /V P A
Short-term Long-term Short-term Long-term incorporation assay and photometric quantification and VPA (RAD/VPA)and then analyzed.Controls transferred to 6-well plates at 500cells per well.86 E.Juengel et al./Cancer Letters 324(2012)83–90
3.6.Analysis of target proteins
The expression level and activity of the drugs’target proteins wasfinally investigated.Chronic use of RAD001for2weeks resulted in deactivation of Akt and reduced expression of p70S6k. There was also a moderate enhancement of histone H3acetylation, compared to the control cell cultures.VPA did not act on Akt in the early phase of therapeutic manipulation,but lowered p70S6k and
Control
RAD
VPA
RAD/VPA
N-cadherin E-cadherin
were treated either with5nM RAD001and/or0.5mM
tumor cells were stained with specific monoclonal
flow cytometer.Thefigure depicts MFU N-cadherin/MFU
documents N-cadherin and E-cadherin staining pattern,taken
anti-N-cadherin,mouse IgG1.
E.Juengel et al./Cancer Letters324(2012)83–9087
simultaneously caused histone H3and H4acetylation (Fig.5A,‘‘short-term’’).The drug combination diminished Akt phosphoryla-tion and p70S6k expression and up-regulated aH3and aH4.Addi-tive effects became prominent with respect to p70S6k and aH3alterations.
In contrast to the short-term response,chronic treatment with RAD001over 12weeks evoked a considerable elevation of pAkt and p70S6k (total and activated).VPA now also caused the re-acti-vati
on of Akt,which exceeded the activation level of the control cultures.The most prominent finding was that VPA no longer up-regulated H3and H4acetylation.However,an enhanced H3and (moderately enhanced)H4acetylation level was still detected in tumor cells treated with the RAD001–VPA combination (Fig.5A,‘‘long-term’’).This result prompts the assumption that the drug combination might prevent resistance development by conserving a high histone acetylation status.To verify this hypothesis,Caki-1cells were transfected with siRNA directed against either HDAC1or HDAC2to augment H3and H4acetylation.Fig.5C demonstrates that knocking down HDAC1mainly elevates aH3,whereas knock-ing down HDAC2elevates both aH3and aH4,compared to the respective controls.Keeping the histone acetylation high was in-deed a necessary prerequisite to significantly block Caki-1growth,as shown in Fig.5B.4.Discussion
Based on studies with cultured endothelial cells,it has been proposed that the effect of mTOR inhibitors varies with the drug dosage,with lower doses leading to a greater propensity to develop undesired feedback loops than higher doses [10,11].The results presented here make this proposal unlikely since both low and high concentrations of RAD001caused the cells to become non-responsive.Therefore,it may be assumed that the duration of drug treatment rather than the drug dosage leads to the development of alternative resistance pathways.
The cell cycle controlling proteins were altered in the RCC cul-tures after RAD001application.Particularly,cdk4began to increase
after long-term application of the drug.The loss of cdk4is coupled to cell growth arrest and re-differentiation in RCC [8,12],hence,up-regulation of this protein following chronic exposure of RAD001may be a feedback mechanism,converting the tumor cell from low to high aggressiveness.The cdk2molecule was markedly expressed in the RCC cultures exposed to long-term RAD001.This is difficult to interpret,since cdk2was also (moderately)elevated in those RCC cultures exposed to short-term RAD001.Based on a synchronized Caki-1model,RAD001(1nM)down-regulated cdk2only within a limited time frame ranging from 1h to 6h post appli-cation,whereas no difference to the controls was seen after 24h [8].The elevation of cdk2,already detectable after 2weeks of RAD001exposure,might therefore be a very early adaptive mech-anism of the tumor,preceding the subsequent loss of growth con-trol,which becomes obvious 10weeks later.Consequently,cdk2may represent an important therapeutic and prognostic marker protein,whose alteration should be carefully followed.This suppo-sition is supported by RAD001resistance in prostate cancer cells being characterized by a large accumulation of cdk2[13].
Doberstein et al.has reported that cyclin D1over-expression is due to chemoresistance in RCC [14].F
urthermore,in vitro and in vivo growth arrest of RCC induced by mTOR inhibition has been associated with suppression of cyclin D1[8,15],which is consid-ered to be the primary regulator of cell proliferation and metastasis [16,17].
Our data show that cyclin D1was strongly up-regulated in RCC cells during prolonged treatment with RAD001.We,therefore,pos-tulate that the cyclin D1increase under RAD001may reflect resis-tance development towards this compound.A significant decrease of cyclin D1could therefore be expected during the early treatment phase,when cells respond to RAD001by reduced growth and pro-liferation.This,however,was not the case.Only a very slight down-modulation of cyclin D1was seen,compared to the un-treated controls,making interpretation difficult.Keeping in mind that ‘‘short-term’’RCC cells were incubated with RAD001for 2weeks,they may possibly have already established an early feed-back loop with cyclin D1representing a sensitive target protein.In
240
10000
200003000040000
50000untreated
siRNA control HDAC1 siRNA HDAC2 siRNA
pp70S6k C o n t r o l
R a d
V P A
R A D /V P A
Long-term
Short-term C o n t r o l
R a d
V P A
R A D /V P A
C e l l n u m b e r
Incubation [h]
HDAC siRNA
aH3 aH4 u n t r e a t e d
s i R N A c o n t r o l H D A C 1 s i R N A
H D A C 2 s i R N A
B
HDAC1 HDAC2 β-actin
u n t r e a t e d
s i R N A c o n t r o l H D A C 1 s i R N A u n t r e a t e d
s i R N A c o n t r o l H D A C 2 s i R N A C
β-actin
β-actin
target proteins,listed in methods.Caki-1cells were treated short-term or long-term remained untreated.Cell lysates were subjected to SDS–PAGE and blotted on the membrane control.The figure shows one representative from three separate experiments.(B)transfected with HDAC1or HDAC2siRNA and knock down was controlled by western growth assay and analyzed as indicated in the methods part (B).One representative 88 E.Juengel et al./Cancer Letters 324(2012)83–90
版权声明：本站内容均来自互联网，仅供演示用，请勿用于商业和其他非法用途。如果侵犯了您的权益请与我们联系QQ:729038198，我们将在24小时内删除。
发表评论