Journal of Virological Methods 222(2015)11–15
Contents lists available at ScienceDirect
Journal of Virological
Methods
j o u r n a l h o m e p a g e :w w w.e l s e v i e r.c o m /l o c a t e /j v i r o m e
t
Short
communication
Construction of an infectious clone of a plant RNA virus in a binary vector using one-step Gibson Assembly
Rosana Blawid,Tatsuya Nagata ∗
Universidade de Brasília,Department of Cell Biology,Campus Universitário Darcy Ribeiro,70910-900Brasília,DF,Brazil
Article history:
Received 2February 2015
Received in revised form 6May 2015Accepted 7May 2015
Available online 15May 2015
Keywords:
Gibson Assembly Seamless cloning
Full-length cDNA clone Tymovirus
a b s t r a c t
The construction of full-length infectious clones of RNA viruses is often laborious due to the many cloning steps required and the DNA exclusion within the plasmid during Escherichia coli transforma-ti
on.We demonstrate single-step cloning procedure of an infectious cDNA of the tomato blistering mosaic virus (ToBMV)using Gibson Assembly (GA),which drastically reduces the number of cloning steps.By agro-inoculation with the construct obtained by this procedure,ToBMV was recovered six days post-inoculation in Nicotiana benthamiana plants.The symptoms induced by the recovered virus were indistinguishable from those caused by the wild-type virus.We conclude that the GA is very useful method particularly to construct a full-length cDNA clone of a plant RNA virus in a binary vector.
©2015Elsevier B.V.All rights reserved.
Recombinant DNA technology has frequently been used dur-ing the last three decades to generate infectious viral clones.Most infectious plant viral RNAs in the 1980s were prepared by in vitro transcription using the small T7,T3or lambda phage promo-ters from plasmids containing genomic cDNA (Cress et al.,1983;Dawson et al.,1986;Dore and Pinck,1988;van Emmelo et al.,1987).The first infectious clone of a plant RNA virus,Brome mosaic virus ,was produced in the 1980s by Ahlquist et al.(1984)in a milestone study.Thereafter,many other infectious clones of plant RNA viruses were constructed.For example,Domier et al.(1989)described a potyvirus infectious cDNA by cloning the full-length genomic cDNA under the T7and T3promoter sequences.The plasmid was designed to gen
erate in vitro transcripts that exactly matched the terminal ends of genomic RNA sequence of the wild-type virus.Reverse genetics has used this approach to study the biology of plant RNA viruses.Several studies in the early 1990s described the infectivity of plasmids containing the 35S promoter of the cauliflower mosaic virus upstream of full-length genomic cDNAs (Mori et al.,1991;Maiss et al.,1992;Commandeur et al.,1991).The construction of full-length genomic cDNA clones usu-ally requires many sequential cloning and sub-cloning steps using restriction enzymes and is often laborious and time consuming.Moreover,the transformation of common strains li with the large constructs often produced plasmids with unwanted deletions,precluding the construction of infectious clones.
∗Corresponding author.Tel.:+556131072980;fax:+556131072904.E-mail address:tatsuya@unb.br (T.Nagata).
Recently,novel cloning procedures have been employed for constructing full-length cDNA clones of plant viruses that do not rely on the use of restriction enzymes.For instance,overlap-extension procedure using thermostable DNA polymerase and ligase in one-step isothermal reaction was shown by Cooper (2014)for the synthesis of tobacco mosaic virus (TMV)full-length genome.Another technique of homologous recombination in yeast and overlap-extension PCR have been successfully
used for construc-ting potyvirus and trichovirus full-length cDNA clones (Desbiez et al.,2012;Youssef et al.,2011).Here we demonstrate a one-step isothermal in vitro recombination reaction using Gibson Assem-bly (GA)(Gibson et al.,2009)to construct a full-length infectious cDNA clone of a plant tymovirus,the tomato blistering mosaic virus (ToBMV).
GA uses three enzymes together in a single reaction:T5exonu-clease,thermostable DNA polymerase and thermostable DNA ligase (Gibson et al.,2009).The T5exonuclease first removes nucleotides at the 5 termini of the DNA fragments,creating single-stranded 3 terminal overhangs.Each fragment for assembly is prepared (nor-mally by PCR)with overlap of ca.15nucleotides to anneal at ends.The DNA polymerase then fills in the gaps and the DNA ligase seals the nicks.T5exonuclease does not compete with DNA polymerase,so the reaction can be performed in a single tube.The procedure has the advantage of no-requiring restriction enzymes for assem-bly and produces assembled sequences without ‘scars’(residual nucleotides after assembly manipulation).Procedures for in vitro DNA recombination have recently been successfully used to assem-ble the Mycoplasma genitalium genome (Gibson et al.,2009),the mouse mitochondrial genome (Gibson et al.,2010),the dengue viral
/10.1016/j.jviromet.2015.05.0030166-0934/©2015Elsevier B.V.All rights reserved.
12
R.Blawid,T.Nagata /Journal of Virological Methods 222(2015)11–15
genome (Siridechadilok et al.,2013),the porcine reproductive and respiratory syndrome viral genome (Suhardiman et al.,2015)and to express multiple siRNAs in mammalian cells (Deng et al.,2014).The protocol used by Cooper (2014)for TMV genome construction resembles the GA,although it is different due to the lack of using exonuclease (5 to 3 direction).Hence the method used by Cooper (2014)was not GA as in vitro recombination,but overlap-extension assembly.
The GA procedure is not still common in construction of infec-tious clones of plant RNA viruses.Here we show for the first time that a one-step GA procedure is used to construct a full-length cDNA clone of a plant RNA virus in a binary vector.
We have applied the GA to mount a plant RNA viral genomic cDNA in a small binary vector,pJL-89(Lindbo,2007).The pJL-89binary vector possesses a cauliflower mosaic virus dual 35S
promoter and the hepatitis delta viral ribozyme sequence for pro-ducing the exact 3 viral end,followed by the NOS (nopaline synthase)terminator.For constructing the full-length cDNA clone of ToBMV,total RNA was extracted from Nicotiana benthamiana plants inoculated with the ToBMV SC50isolate (NC 021851)(de Oliveira et al.,2013),presenting typical symptoms using the ZR Plant R
NA MiniPrep TM kit (Zymo Research,Irvine,USA).Follow-ing the manufacturer’s instructions,cDNA was synthesized at 55◦C using Superscript III reverse transcriptase (Life Technologies,Grand Island,NY,USA),and the ToBMV NdeI reverse primer (Table 1)to generate    6.3kbp first-strand cDNA of the ToBMV genome.One microliter of diluted cDNA (1:10in water)was amplified by PCR using Phusion DNA High-Fidelity polymerase (New England BioLabs,Ipswich,USA)with ToBMV forward and ToBMV reverse primers (Table 1)containing sequences overlapping with the
Table 1
Sequences of the oligonucleotides used in the RT-PCR and PCR in this work.
Name
Sequence (5 →3 )
Size of overlapping sequences
Amplicon ToBMV NdeI reverse (NdeI site in italics)TT CATATG GTTTCCGATACCCTCGG
ToBMV cDNA ToBMV forward CATTTCATTTGGAGAGGGTATTTATAACCAGATCAATCCTCTTC 17nts ToBMV ToBMV reverse ATGCCATGCCGACCCTGGTTTCCGATACCCTCG 15nts
ToBMV pJL89forward GGGTCGGCATGGCATCTC
clonepJL-89pJL89reverse
CCTCTCCAAATGAAATGAACTTCC
pJL-89
Underlined sequences represent the overlapping region with the pJL-89vector
nucleotides.
Fig.1.Strategy for constructing the ToBMV agroinfectious clone with a one-step in vitro DNA-assembly recombination.Primers containing overlapping sequences were used to generate two fragments of DNA.The amplified ToBMV cDNA was generated with primers containing sequences overlapping the binary vector (blue,ToBMV sequence;red,overlapping sequences between forward and reverse primers.Both primer sequences in red and black are originated from pJL-89binary vector).(For interpretation of the references to color in this figure legend,the reader is referred to the web version of this article.)
R.Blawid,T.Nagata/Journal of Virological Methods222(2015)11–1513
pJL-89binary vector(Table1and Fig.1).The vector fragments were also prepared by PCR using the specific pJL89forward primer that anneals to the HDV ribozyme region and the pJL89reverse primer that anneals to the promoter region producing a4.7kbp amplicon(Table1and Fig.1).The pJL-89PCR fragments were puri-fied using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare,Uppsala,Sweden),and the ToBMV full-length PCR fragments were purified using the QIAEX II Gel Extraction Kit(Qia-gen,Hilden,Germany)to minimize the artificial DNA nicks during the purification steps.The purified PCR products were assembled in an isothermal GA reaction(Gibson Assembly®Cloning Master Mix) following the standard protocol(New England BioLabs).Briefly,3␮
l Fig.2.(A)Comparison of symptoms(13dpi)caused by the full-length clone recovered by agro-inoculation and the wild-type ToBMV(accession number KC840043).The infected N.benthamiana leaves by the full-length clone of ToBMV was used as inoculum source.(a)Physalis pubescens,(veinal clearing and blistering);(b)Datura stramonium, (necrotic ring spots,mosaic and blistering);(c)Solanum lycopersicum cv.Santa Clara,(mosaic and blistering);(d)Chenopodium quinoa,(chlorotic spots);(e)Capsicum annuum cv.Ikeda(no symptoms)and(f)Nicotiana tabacum cv.TNN(no symptoms).Four tested plants for each species were mechanically inoculated.(B)The results of the dot-blot immunobinding assay from the mechanical inoculation experiment.Four different full-length clones(clones1to4)were used for this experiment.Mock inoculated plants were used as negative controls.(C)Symptoms in N.benthamiana plants.(a)inoculated plant with the wild-type ToBMV;(b)agroinfiltrated plant with the full-length ToBMV clone1;(c)agroinfiltrated plant with the pJL-89empty vector and(c)mock-inoculated plant.
14R.Blawid,T.Nagata/Journal of Virological Methods222(2015)11–15
of the gel-purified pJL-89vector(70ng/␮l),7␮l of the gel-purified viral cDNA(140ng/␮l)and10␮l of the2X GA master mix were incubated at50◦C for2h.The reaction was performed in a total volume of20␮l containing a total of0.057pmol of the DNA frag-ments.Following incubation,the reaction soluti
on was dialyzed using a cellulose membrane(VSWP,0.025␮m)(Merck-Millipore, Darmstadt,Germany),and2␮l of the reaction products were sub-sequently electroporated to li DH10B(Life Technologies) and DH5␣(Life Technologies)strains.Colonies were grown at28 and37◦C for comparison.Fig.1shows the designed GA construct for generating the ToBMV infectious cDNA clone.
Restriction enzyme analysis of the plasmids showed that nine of ten colonies of li DH10B cells grown at28◦C contained plasmids with the expected size.When colonies were grown at37◦C,only three out of ten clones of DH10B showed the expected profiles of restriction enzyme digestion.None of the extracted plasmids from transformed DH5␣cells grown at 28◦C(ten clones)or37◦C(ten clones)had the expected plasmid size.Therefore,the strain li used and the incubation tem-perature are thus both important when performing GA in vitro recombination for constructing the full-length infectious ToBMV clone.li cells are designed for the maintenance of large plasmids.They have high transformation efficiency(Durfee et al.,2008)and are ideal for propagating the full-length infectious cDNA clone.Finally,the GV3101:pMP90strain(background C58; pTiC58DT-DNA)of Agrobacterium tumefaciens was transformed with the selected clones.
Wefirst verified if the full-length ToBMV clones were able to infect N.benthamiana plants via agro-infiltration.Transformed agrobacteria containing the full-length ToBMV cDNA clone were grown overnight at28◦C in LB3medium(containing50␮g/ml of rifampicin and50␮g/ml of kanamycin).The cells were then pelleted and diluted,and20N.benthamiana plants were agro-infiltrated at an OD of0.8,essentially as described by Bucher et al.(2003).The transformed agrobacteria containing only the binary vector pJL-89was used as negative control.Symptoms were monitored for21days.The symptoms of the agro-infiltrated N.ben-thamiana plants were comparable to those originally described for the wild-type ToBMV.Six days post-inoculation(dpi),all20plants showed the same visual symptoms of mottling,mosaic and blister-ing described by de Oliveira et al.(2013).No visual symptoms were observed with agroinfiltrated N.benthamiana plants containing the pJL-89vector alone(Fig.2).Viral infection was confirmed for all N.benthamiana plants by dot-blot and tissue-print immunobind-ing assays(modified protocol from Hibi and Saito,1985)using an antibody raised against the purified ToBMV preparation(kindly provided by Dr.Alice K.Inoue-Nagata,Embrapa-Hortalic¸as,Brasília, Brazil).Briefly,grounded leaf samples(1×PBS,pH7.4)were blot-ted onto a nitrocellulose membrane and blocked for one hour with 1×PBS plus0.05%Tween(PBS-T),5%skimmed milk and1%Triton X-100.Membrane was washed three times for15min with TBS-T and the primary antibody against ToBMV(0.3␮g/ml)was added and incubated at4◦C overnight.After t
hree times washing steps the alkaline phosphatase-conjugated secondary antibody(0.2␮g/ml in TBS-T)was incubated for1h at room temperature.Staining was performed by a colorimetric assay using the NBT/BCIP system.
We then determined the host-plant spectrum of the full-length ToBMV clone.Systemically infected N.benthamiana leaves were used as the inoculum source for the mechanical-inoculation exper-iment(using50mM phosphate buffer,pH7.0,0.1%sodium sulfite). Six test species were chosen:Physalis pubescens,Datura stramo-nium,Solanum lycopersicum cv.Santa Clara,Chenopodium quinoa, Capsicum annuum cv.Ikeda and Nicotiana tabacum cv.TNN.In this experiment,mock-inoculated healthy plants were used as nega-tive controls.As observed previously(de Oliveira et al.,2013),D. stramonium and P.pubescens were good propagation hosts.Veinal clearing,mosaic and blistering were observed at5dpi in both test species.With the exception of C.annuum cv.Ikeda and N.tabacum cv.TNN,all plants were positive for ToBMV infection,confirmed by dot-blot immunobinding assays(Fig.2).The experiment was monitored for30dpi.Fig.2shows the symptoms produced by the full-length ToBMV cDNA clone in the tested plants and the results of the dot-blot immunobinding assay.
This is thefirst report of the generation of a full-length cDNA clone of tymovirus genome using a one-
step in vitro recombina-tion assay.Our result showed the high efficiency in obtaining the desired clones for two-fragment assembly(nine correct clones out of10).The comparative high efficiency of GA was also reported for four fragments assembly of approximately5kbp each(de Kok et al., 2014).Another technical key for the construction of infectious clone is to prepare larger genomic cDNA fragments by PCR.In our study, the cDNA of whole viral genome(6.3kbp)was amplified in one-step PCR using Phusion DNA High-Fidelity polymerase.However, the longer full-length genomic cDNA amplification by single PCR reaction may be hampered due to the size-dependent difficulties. In fact,we could not amplify a potyviral cDNA genome in a single PCR(data not shown).In such cases the GA may allow to divide more numbers of fragments.Actually,we have successfully used GA to construct full-length clones of an animal RNA virus using three fragments of ca.5kbp each(unpublished).
The Tymovirus genus currently contains27species which have been recognized by the International Committee on Taxonomy of Viruses(ICTV,December2014).Of these,only a few tymoviruses, such as Turnip yellow mosaic virus(TYMV),Eggplant mosaic virus, Ononis yellow mosaic virus(Skotnicki et al.,1993)and Asclepias asymptomatic virus(Min et al.,2012)have been manipulated to produce infectious transcripts,and only TYMV have been used for constructing agroinfectious cDNA clones(Powell et al.,2012).
The main advantage of an agroinfectious clone is the simple pro-cedure to prepare inoculum to the host plants,by just culturing the transformed agrobacteria.However,the attempt to construct agroinfectious cDNA clones using normal restriction enzyme-based protocols is usually laborious and,in many cases,not successful.The GA was shown as the powerful tool to construct the agroinfectious cDNA clones of plant RNA virus.
Acknowledgments
We want to acknowledge the contribution of Dr.Alice K. Inoue-Nagata for providing the ToBMV antibody and of Ms.Stella Oliveira for the excellent technical support.We are grateful to the National Council of Technological and Scientific Development (CNPq479161/2013-5)for thefinancial support.
References
Ahlquist,P.,French,R.,Janda,M.,Loesch-Fries,S.,1984.Multicompetent RNA plant virus infection derived from cloned viral cDNA.Proc.Natl.Acad.Sci.U.S.A.81, 7066–7070.
Bucher,E.,Sijen,T.,De Haan,P.,Goldbach,R.,Prins,M.,2003.Negative-strand tospoviruses and tenuiviruses carry a gene for a suppressor of gene silencing at analogous genomic positions.J.Virol.77,1329–1336.
Commandeur,U.,Jarausch,W.,Li,Y.,Koenig,R.,Burgermeister,W.,1991.cDNAs of beet necrotic yellow vein virus RNAs3and4are rendered biologically active in
a plasmid containing the cauliflower mosaic virus35S promoter.Virology185,
493–495.
Cooper,B.,2014.Proof by synthesis of Tobacco mosaic virus.Genome Biol.15,R67. Cress,D.E.,Kiefer,M.C.,Owens,R.A.,1983.Construction of infectious potato spindle tuber viroid cDNA clones.Nucleic Acids Res.11,6821–6835.
Dawson,W.O.,Beck,D.L.,Knorr,D.A.,Grantham,G.L.,1986.cDNA cloning of the com-plete genome of tobacco mosaic virus and production of infectious transcripts.
Proc.Natl.Acad.Sci.U.S.A.83,1832–1836.
de Kok,S.,Stanton,L.H.,Slaby,T.,Durot,M.,Holmes,V.F.,Patel,K.G.,Platt,D.,Sha-pland,E.B.,Serber,Z.,Dean,J.,Newman,J.D.,Chandran,S.S.,2014.Rapid and reliable DNA assembly via ligase cycling reaction.ACS Synth.Biol.21,97–106.
R.Blawid,T.Nagata/Journal of Virological Methods222(2015)11–1515
de Oliveira,V.C.,Nagata,T.,Guimarães,F.C.,Ferreira,F.A.,Kitajima,E.W.,Nicolini,
C.,de Oliveira Resende,R.,Inoue-Nagata,A.K.,2013.Characterization of a novel
tymovirus on tomato plants in Brazil.Virus Genes46,190–194.
Deng,F.,Chen,X.,Liao,Z.,Yan,Z.,Wang,Z.,Deng,Y.,Zhang,Q.,Zhang,Z.,Ye,J.,Qiao, M.,Li,R.,Denduluri,S.,Wang,J.,Wei,Q.,Li,M.,Geng,N.,Zhao,L.,Zhou,G.,Zhang, P.,Luu,H.H.,Haydon,R.C.,Reid,R.R.,Yang,T.,He,T.C.,2014.A simplified and versatile system for the simultaneous expression of multiple siRNAs in Mam-malian cells using Gibson DNA assembly.PLoS ONE,/10.1371/ journal.pone.0113064(eCollection2014).
Desbiez,C.,Chandeysson,C.,Lecoq,H.,Moury,B.,2012.A simple,rapid and efficient way to obtain infectious clones of potyvirus.J.Virol.Methods183,94–97. Domier,L.L.,Franklin,K.M.,Hunt,A.G.,Rhoads,R.E.,Shaw,J.G.,1989.Infectious in vitro transcripts from cloned cDNA of a potyvirus,tobacco vein mottling virus.
Proc.Natl.Acad.Sci.U.S.A.86,3509–3513.
Dore,J-M.,Pinck,L.,1988.Plasmid DNA containing a copy of RNA3can substitute for RNA3in Alfalfa m
osaic virus RNA inocula.J.Gen.Virol.69,1331–1338. Durfee,T.,Nelson,R.,Baldwin,S.,Plunkett,G.,Burland,V.,Mau,B.,Petrosino,J.F., Qin,X.,Muzny,D.M.,Ayele,M.,Gibbs,R.A.,Csörgo,B.,Pósfai,G.,Weinstock,
G.M.,Blattner,F.R.,2008.The complete genome sequence of Escherichia coli
DH10B:insights into the biology of a laboratory workhorse.J.Bacteriol.7, 2597–2606.
Gibson,G.D.,Smith,O.H.,Hutchison,A.C.,Venter,C.J.,Merryman,C.,2010.Chemical synthesis of the mouse mitochondrial genome.Nat.Methods11,901–903. Gibson,G.D.,Young,L.,Chuang,Y.R.,Venter,C.J.,Hutchison,C.A.,Smith,H.O.,2009.
Enzymatic assembly of DNA molecules up to several hundred kilobases.Nat.
Methods5,343–345.
Hibi,T.,Saito,Y.,1985.A dot immunobinding assay for the detection of Tobacco mosaic virus in infected tissues.J.Gen.Virol.66,1191–1194.
Lindbo,J.,2007.TRBO:a high-efficiency Tobacco mosaic virus RNA-based overex-pression vector.Pla
nt Physiol.145,1232–1240.Maiss,E.,Timpe,U.,Brisske-Rode,A.,Lesemann,D.E.,Casper,R.,1992.Infectious in vivo transcripts of a plum pox Potyvirus full-length cDNA clone containing the cauliflower mosaic virus35S RNA promoter.J.Gen.Virol.73,709–713. Min,B.E.,Feldman,T.S.,Ali,A.,Wiley,G.,Muthukumar,V.,Roe,B.A.,Roossinck,M., Melcher,U.,Palmer,M.W.,Nelson,R.S.,2012.Molecular characterization,ecol-ogy,and epidemiology of a novel Tymovirus in Asclepias viridis from Oklahoma.
Phytopathology102,166–176.
Mori,M.,Mise,K.,Kobayashi,K.,Okuno,T.,Furusawa,I.,1991.Infectivity of plasmids containing brome mosaic virus cDNA linked to the cauliflower mosaic virus35S RNA promoter.J.Gen.Virol.72,243–246.
Powell,J.D.,Barbar,E.,Dreher,T.W.,2012.Turnip yellow mosaic virus forms infec-tious particles without the native beta-annulus structure andflexible coat protein N-terminus.Virology422,165–173.
Siridechadilok,  B.,Gomutsukhavadee,M.,Sawaengpol,T.,Sangiambut,S.,Put-tikhunt,  C.,Chin-inmanu,K.,Suriyaphol,P.,Malasit,P.,Screaton,G., Mongkolsapaya,J.,2013.A simplified positive-sense-RNA virus construction approach that enhances analysis throughput.J.Virol.23,12667–12674. Skotnicki,M.L.,Ding,S.W.,Mackenzie,A.M.,Gibbs,A.J.,1993.Infectious eggplant mosaic tymovirus and
ononis yellow mosaic tymovirus from cloned cDNA.Arch.
Virol.131,47–60.
Suhardiman,M.,Kramyu,J.,Narkpuk,J.,Jongkaewwattana,A.,Wanasen,N.,2015.
Generation of porcine reproductive and respiratory syndrome virus by in vitro assembly of viral genomic cDNA fragments.Virus Res.195,1–8,dx.doi.
org/10.1016/j.virusres.2014.09.008
van Emmelo,J.,Ameloot,P.,Fiers,W.,1987.Expression in plants of the cloned satel-lite tobacco necrosis virus genome and of derived insertion mutants.Virology 157,480–487.
Youssef,F.,Marais,A.,Faure,C.,Gentit,P.,Candresse,T.,2011.Strategies to facilitate the development of uncloned or cloned infectious full-length viral cDNAs:Apple chlorotic leaf spot virus as a case study.Virol.J.8(488),1–12.

版权声明：本站内容均来自互联网，仅供演示用，请勿用于商业和其他非法用途。如果侵犯了您的权益请与我们联系QQ:729038198，我们将在24小时内删除。