KAPA Library Preparation Kit
Ion Torrent™ Platforms
KR0573 - v1.13
Product Description
This KAPA Library Preparation Kit is designed for the preparation of libraries for sequencing on the Ion Personal Genome Machine™ (PGM™) and Ion Proton™semiconductor sequencers. The kit provides all of the enzymes and reaction buffers required for constructing libraries from 100 ng – 1 µg of fragmented, double-stranded DNA via the following steps:
1. End repair: Produce blunt-ended, 5'-phosphorylated
fragments.
2. Adapter ligation and nick repair: Ligate dsDNA
adapters to blunt-ended library fragments and perform nick repair to yield library fragments flanked by adapters.
3. Library amplification (optional): Perform PCR to
amplify library fragments carrying appropriate adapter sequences on both ends.
The kit provides all of the enzymes and buffers required for library construction and amplification, but does not include adapters or SPRI® beads. Enzyme formulations and reaction buffers for end repair, and ligation and nick repair are supplied in convenient, concentrated formats. Adapters are available separately (KK8330, KK8331, KK8332 or KK8333). These formulations ensure maximum stability of the reagents and high reaction efficiencies, while simplifying reaction setup.
In order to maximize sequence coverage uniformity, it is critical that library amplification bias be kept to a minimum. KAPA HiFi DNA Polymerase has been designed for low-bias, high-fidelity PCR, and is the reagent of choice for next generation sequencing (NGS) library amplification1, 2, 3. The KAPA Library Preparation Kit for Ion Torrent™ (KK8300 and KK8301) includes KAPA HiF i HotStart ReadyMix (2X) and an adapter-specific primer mix for library amplification. Primer sequences are: Primer P1:5' – CCACTACGCCTCCGCTTTCCTCTCTATG – 3' Primer A:  5' – CCATCTCATCCCTGCGTGTC – 3'
Kits without library amplification components (KK8310 and KK8311) are also available for PCR-free workflows.
1Oyola, al. BMC Genomics 13, 1 (2012).
2Quail M.A. et al. Nature Methods 9, 10 – 11 (2012).
3  Quail M.A. et al. BMC Genomics 13,
341 (2012).*KK8310 and KK8311 are available for PCR-free workflows and do not contain KAPA HiFi HotStart ReadyMix or Library Amplification Primer Mix.
Product Applications
The KAPA Library Preparation Kit for Ion Torrent™ Platforms is ideally suited for NGS library construction workflows that involve end repair, adapter ligation and nick repair, and library amplification (optional). The protocol may be adapted for incorporation into workflows for a wide range of NGS applications, including:
• Targeted sequencing by solution hybrid selection
• Amplicon sequencing
• Whole-genome shotgun sequencing
• RNA-seq
• ChIP-seq
1
Technical Data Sheet
Effective date: June 2013
Product Specifications
Shipping and storage
The enzymes supplied in this kit are temperature sensitive, and appropriate care should be taken during shipping and storage. KAPA Library Preparation Kits are shipped on dry ice or ice packs, depending on the country of destination. Upon receipt, immediately store enzymes, reaction buffer components, adapters and primers at -20 °C in a constant-temperature freezer. When stored under these conditions and handled correctly, the kit components will retain full activity until the expiry date indicated on the kit label.
Handling
Always ensure that components have been fully thawed and thoroughly mixed before use. Keep all enzyme components and master mixes on ice as far as possible during handling and preparation. KAPA HiF i HotStart ReadyMix (2X) contains isostabilizers and may not freeze solidly, even when stored at -20 °C. Nevertheless, always ensure that the KAPA HiF i HotStart ReadyMix is fully thawed and thoroughly mixed before use.
Quality control
All kit components are subjected to stringent functional quality control, are free of detectable contaminating exo– and endonuclease activities, and meet strict requirements with respect to DNA contamination. Please contact support@kapabiosystems for more information. Important Parameters
Master Mixes
• This kit and protocol is designed to be compatible with both low-throughput, manual library construction and high-throughput, automated workflows. F or this reason, and for ease of use, components are combined into master mixes, rather than dispensed separately into individual reactions.
• Master mixes for End Repair as well as Ligation and Nick Repair, prepared as recommended in Tables 3 and 4 of this protocol, are stable for up to 7 days at -20 °C, and overnight at 4 °C.
Paramagnetic SPRI® beads and reaction cleanups • Cleanups should be performed in a timely manner to ensure that enzyme reactions do not proceed beyond optimal incubation times.
• This protocol has been validated using Agencourt®AMPure® XP reagent (Beckman Coulter, part nu
mber A63880, A63881 or A63882). Solutions and conditions for DNA binding and size selection may differ if other beads are used.
• Observe all manufacturer's storage and handling recommendations for AMPure® XP reagent.
• Beads will settle gradually; always ensure that they
are fully resuspended before aspirating AMPure® XP reagent.
• The incubation times provided in the protocol for reaction cleanups and size selection are provided as guidelines only, and should be modified/optimized according to your current protocols, previous experience, and specific equipment and samples in order to maximize library construction efficiency and throughput.
• The time required to completely capture magnetic beads varies according to the reaction vessel and magnet used. It is important not to discard or transfer any beads with the removal or transfer of the supernatant. Capture times should be optimized accordingly.
• The volumes of 80% ethanol used for the bead washes may be adjusted to accommodate smaller reaction vessels and/or limited pipetting capacity, but it is important that the beads are entirely submer
ged during wash steps.
• It is important to remove all ethanol before proceeding with subsequent reactions. However, over-drying of the beads may make them difficult to resuspend,  and may result in a dramatic loss of DNA. Drying of beads for at room temperature for 3 - 5 min should be sufficient.
Drying of beads at 37 °C is not recommended.
• Where appropriate, DNA should be eluted from beads in 10 mM Tris-HCl (pH 8.0). Elution of DNA in PCR-grade water is not recommended, as DNA is unstable in unbuffered solutions.
Input DNA
• This protocol has been validated for library construction from 100 ng – 1 μg of appropriately fragmented, double-stranded DNA, but libraries can be prepared from lower input amounts if the sample represents sufficient copies to ensure the requisite coverage and complexity in the final library.
• If input DNA is quantified before fragmentation, and/or fragmented DNA is subjected to a SPRI® cleanup or size selection prior to end repair, the actual input into library construction may be significantly lower. This should be taken into account when evaluating th e efficiency of the process an
d/or during optimization of library amplification cycle number.
• The proportion of fragmented DNA that is converted to adapter-ligated molecules is typically between 5 and 15%. This applies to high quality DNA and can be significantly lower for DNA of lower quality, e.g. FFPE samples. Workflows that contain additional SPRI®cleanups or size selection prior to library amplification are likely to result in a lower yield of adapter-ligated molecules.
• Solutions containing high concentrations of EDTA and strong buffers may negatively affect the end repair reaction, and should be avoided. F ragmentation of DNA in water is not recommended.
2
Adapter concentrations
• The recommended adapter concentration is dependent on the amount of input DNA, and the median fragment size of the library. As a general guideline, we recommend an adapter:insert molar ratio of between 10:1 and 20:1.
• The recommended adapter concentrations for 130, 260, 320 and 410 bp inserts, prepared from 100 ng –
1 µg of input DNA, are provided in Table 1.
• KAPA Adapters are supplied at a concentration of 10  µM. When 10 µl of each adapter is used per
70 µl Ligation and Nick Repair reaction, the final
concentration of each adapter is 1.4 µM.
• If a lower final concentration is required, we recommend dilution of the 10 µM adapters to the appropriate concentration, such that addition of 10 µl of each diluted adapter to a 70 µl Ligation and Nick Repair reaction will result in the recommended final adapter concentration, as shown in Table 1.
• While it is not necessary to adjust adapter concentrations to accommodate moderate sample-to-sample variation in input DNA quantity, we recommend using an adapter concentration that is appropriate for the molar concentration of input DNA.
It is important to maintain an adapter:insert ratio of ≥10:1 in order to minimize the formation of chimeric library inserts. Conversely, adapter:insert ratios higher than 20:1 may lead to reduced library yields.
Post-ligation cleanup
• Ion Torrent™ adapters do not readily ligate to form dimers as they are not 5' phosphorylated. A single cleanup after ligation and nick repair may therefore be sufficient, as unligated adapters are unlikely to interfere in qPCR-based library quantification and template preparation (emPCR). However, for complete removal of all adapter products after the ligation and nick repair reaction, two SPRI® beads clean-ups are required. • Ligation and Nick Repair buffer contains a high concentration of PEG 6000, which will interfere with efficient size selection. If size selection is performed between adapter ligation and library amplification (or template preparation), a single post-ligation cleanup
with SPRI® beads is recommended.
• T he volume used to resuspend the washed beads after the post-ligation cleanup(s) should be adjusted to suit your chosen workflow:
• If proceeding directly to library amplification, you should determine an appropriate final volume in
which to elute the library DNA. You may wish to
divert and/or reserve some of this library material
for archival and/or QC purposes. A single 50 µl
library amplification reaction as described in this
protocol usually yields ~1 µg of DNA, and requires
20 µl of input DNA; a final elution volume of 22 –
25 µl is therefore recommended to allow for some
liquid remaining in the tube.
• If proceeding with size selection, elute the library DNA in an appropriate volume according to the size
selection method that you will use.
Size selection
• Size selection requirements vary widely according to specific applications. Size selection may be achieved by means of a variety of common methods including:• Dual-SPRI® size selection
• Manual agarose gel electrophoresis, excision and purification
• Automated DNA size selection (e.g. Sage Science Pippin Prep™)
• Size selection inevitably leads to a loss of sample material. Depending on the details, these losses can be dramatic (>80%), significantly increasing the number of amplification cycles needed to generate sufficient material for sequencing. The potential advantages of one or more size selection steps in a library construction workflow should be weighed against the potential loss of library complexity, especially when input DNA is limited. A carefully optimized fragmentation protocol, especially for shorter insert libraries, may eliminate the need for size selection, thereby simplifying the library construction process and limiting sample losses.
3
Table 1. Recommended adapter concentrations (10 µl of stock per 70 µl Ligation and Nick Repair reaction)
Size Selection (continued)
• While size selection is usually carried out after adapter ligation and before library amplification, it may be inserted at alternative points in the overall workflow as follows:
• prior to end repair of fragmented DNA, or
• after library amplification.
• This protocol provides recommendations for dual-SPRI® size selection of 200, 330, 390 and 480 bp libraries. However, dual-SPRI® size selection is sensitive to multiple factors and any size selection protocol should be carefully optimized and validated before it is used for precious samples.
Library amplification
• The enzyme provided in KAPA HiFi HotStart ReadyMix is an antibody-based hot start formulation of KAPA HiF i DNA Polymerase, a novel B-family DNA polymerase engineered for increased processivity
and high fidelity. KAPA HiFi HotStart DNA Polymerase has 5'g3' polymerase and 3'g5' exonuclease (proofreading) activities,  but no 5'g3' exonuclease activity. The strong 3'g5' exonuclease activity result
s in superior accuracy during DNA amplification. The error rate of KAPA HiF i HotStart DNA Polymerase is
2.8 x 10-7 errors/base, equivalent to 1 error in
3.5 x 106
nucleotides incorporated.
• Excessive library amplification can result in unwanted artifacts such as PCR duplicates, chimeric library inserts, amplification bias and heteroduplex formation.
It is generally best to limit the extent of library amplification as far as possible, while ensuring that sufficient material is generated for QC and downstream processing (e.g. target enrichment or sequencing).
The effects of over-amplification are demonstrated in Figures 1 and 2.
reaction order• In general, libraries prepared from 1 µg input gDNA do not require amplification, while libraries prepared from less than 100 ng do require amplification. To determine whether samples require amplification, quantify the libraries with the KAPA Library Quantification Kit for Ion Torrent™.
• Table 2 provides typical library yield and concentration following library amplification of adapter-ligated, non-size-selected libraries prepared from 100 ng and 1 µg DNA, for various numbers of PCR cycles. Note that size selection and other factors related to your particular workflow will determine the actual amount of adapter-ligated library DNA available for PCR amplification.• If cycled to completion (not recommended), a single
50 µl library amplification PCR, performed as described
in this protocol, can produce ~1.5 – 2 µg of amplified library (30 – 40 ng/µl). To minimize over-amplification and associated undesired artifacts, the number of amplification cycles should be optimized to produce ~0.5 – 1.5 µg of amplified library (10 – 30 ng/µl). • If it is necessary to obtain more DNA, we recommend that you first ensure that the reaction is fully optimized, and then perform multiple 50 µl reactions per sample rather than increasing the PCR volume.
• F igure 1 illustrates typical yields following library amplification for various numbers of PCR cycles as quantified by qPCR, Bioanalyzer and Quant-IT™ PicoGreen®. Yields calculated by qPCR reach
a plateau at ~2 µg total yield per 50 µl. Conversely,
library concentrations determined using Bioanalyzer and Quant-IT™ PicoGreen® assays show a different pattern and appear to be less reliable for libraries amplified for greater numbers of PCR cycles.
• This discrepancy is likely due to the depletion of primers and/or dNTPs in later PCR cycles. Under these conditions, single-stranded DNA molecules are no longer efficiently converted to double-stranded DNA, and instead dissociate during the thermal denaturation step and then anneal imperfectly to antisense strands that are only partially complementary. This presumably results in the formation of so-called "daisy chains"
comprising large assemblies of improperly annealed, partially double-stranded, heteroduplex DNA. The Quant-IT™ PicoGreen® assay is specific for double-stranded DNA and thus the single-stranded component of "daisy-chain" molecules in over-amplified samples leads to under-estimation of the DNA concentration.• Quantification using a double-stranded DNA-specific Bioanalyzer assay (e.g. the Agilent High Sensitivity DNA Kit; see F igure 2) is also problematic for such samples, as equivalent masses of single- and double-stranded DNA likely do not produce the same amount of fluorescence. Additionally, the heteroduplex library fragments migrate slowly during electrophoresis and are represented as high molecular weight species, leading to difficulties in setting baselines and estimating
the true average library size.
Table 2. Predicted library amplification yield.
Library amplification reactions were cleaned up using one volume of AMPure® XP reagent and eluted in 50 µl. Concentrations were determined by qPCR using the KAPA Library Quantification Kit for Ion Torrent™, and molar concentrations were calculated assuming an average fragment
length of 300 bp.
4
a
b
Figure 1. Yield of PCR-amplified libraries as determined by three quantification methods. Library amplification was performed with increasing numbers of PCR cycles according to the recommended pr
otocol, using libraries prepared from 1 µg (a) or 100 ng (b) of input DNA. Reactions were cleaned up using one volume of AMPure ® XP reagent and eluted in 50 µl. Amplified library concentrations were determined by Bioanalyzer, Quant-IT ™ PicoGreen ®, or qPCR (KAPA Library Quantification Kit).
a
b
Figure 2. Excessive library amplification leads to high molecular weight DN A heteroduplexes, or "daisy chains". Library amplification reactions of libraries prepared from 100 ng DNA were cleaned up using one volume of AMPure ® XP reagent after library amplification for 6 (a) or 20 cycles (b). Libraries were analysed using the Agilent Bioanalyzer High Sensitivity DNA Kit.
Assessing the library and proceeding to template preparation
• Your specific library construction workflow should be tailored and optimized to yield a sufficient amount of adapter-ligated molecules of the desired size distribution for template preparation and sequencing, as well as for QC and archiving purposes. • Library size distribution, and the absence of primer dimers and/or over-amplification products, should be confirmed by means of an electrophoretic method.• To determine the required library dilution for template preparation, library quantification can be performed  by electrophoretic methods, or by using the KAPA Library Quantification Kit for Ion Torrent ™.
5
2.52
1.5
10.50
Cycles
Y i e l d  (µg )
2.52
1.5
10.50Cycles
Y i e l d  (µg )

版权声明：本站内容均来自互联网，仅供演示用，请勿用于商业和其他非法用途。如果侵犯了您的权益请与我们联系QQ:729038198，我们将在24小时内删除。