Enabling Life Science Tools Based On Mass Spectrometry™
Application
Notes
Automated genopure DNA purifi cation for MALDI-TOF-MS based genotyping and sequencing of the blood clotting factor V (F5)
Leiden allele
Introduction
In blood clotting, activated factor V (factor Va) acts as an essential cofactor for the conversion of prothrombin to thrombin by factor Xa. Thrombin cleaves factor V into its active form, while factor Va is inactivated by activated protein C (APC). The guanine to adenine exchange at nucleotide position 1691 in exon 10 of the factor V gene (F5) causes the amino acid substitution of Arg 506 to Gln on the protein level [1].
This variant, commonly known as
factor V Leiden, is highly resistant to the regulatory inactivation by APC. Factor V Leiden increases the risk of venous thrombosis 4- to 8-fold in heterozygous and 50- to 100-fold in homozygous individuals and, thereby, is the most common cause For enhanced sample throughput in genotyping of the factor V Leiden allele, an automated DNA purifi cation method has been used prior to MALDI-TOF MS analysis. This method utilizes the genopure™ magnetic bead purifi cation kit and the map II/pure™ robotic platform. The results obtained by MALDI-TOF MS were verifi ed by DNA sequencing.
# MT-63 - fl ex series
for hereditary thrombophilia [2]. Its prevalence varies in populations of different ethnic origin. Heterozygosity for factor V Leiden is found in 3 to 8% of the overall US and European populations. In contrast, the mutation is extremely rare in Asian, African, and indigenous Australian populations [3, 4]. Due to the high prevalence associated with signifi
cantly enhanced risk for thrombosis, the blood clotting factor V Leiden allele (F5 G1691A) represents an important clinical target for high throughput screening [4, 5].By its inherent high sensitivity,
mass accuracy and reproducibility,
MALDI-TOF MS-based genotyping
of single nucleotide polymorphisms
(SNPs) offers a promising technical alternative to common electrophoretic
and chromatographic techniques [5, 6]. However,  the MALDI process
requires the removal of interfering
ions, especially sodium and potassium cations. In addition, high throughput work requires an automated procedure for sample preparation and purifi cation.Following PCR amplifi cation of F5
exon 10 in 96-well plates out of genomic DNA, PCR products were
purifi ed with genopure ds magnetic
bead system on a mapII/pure robotic
platform. Purifi ed PCR products were controlled by gel electrophoresis.
The purifi ed PCR products were
utilized as templates for the F5
Fig. 1: Gel electrophoresis of F5 PCR
amplimers.
Lanes 1-2: Unpurifi ed F5 PCR product Lanes 3-8: genopure ds-purifi ed F5 PCR product
allele specifi c primer extension assay generating informative elongated oligonucleotides. Following the MALDI compatible purifi cation of the extension products by the automated genopure oligo magnetic bead system, genotypes were determined by exact analysis of molecular masses using a BIFLEX
III™ MALDI-TOF MS instrument. All MS-based genotyping results were confi rmed by DNA sequencing: After
the cycle-sequencing reaction using genopure ds purifi ed PCR-products
as templates and a fi nal purifi cation
of the products by the automated
genopure oligo magnetic bead system,
sequences were determined on an
automated DNA sequencer.
Material and Methods
Extraction of genomic DNA
Chromosomal leukocyte DNA was extracted from peripheral EDTA-blood by using the RapidPrep Macro Genomic DNA Isolation Kit (Pharmacia, Germany) according to
the manufacturer‘s protocol.
PCR amplifi cation The PCR reactions (10 µl)
contained 12 pmol of both forward
and reverse primers (F5:
Fig. 3: Sequencing
results of the FV
gene.
a) Genomic
sequence of the
PCR fragment
including exon 10 of
wild type FV gene.
b) Genomic region
of the FV gene, nucleotide 1685 to
1696.
Fig. 2: MALDI-
TOF-MS based
genotyping of factor
V Leiden allele F5
(G1691A).
a) Schematic primer
extension assay
(nucleotides 1670
to 1702).
b) MALDI-TOF-MS spectra of the
homozygous wild
type allele (sample
A), homozygous
factor V Leiden
allele (sample B),
and heterozygous factor V Leiden allele (sample C).
The molecular
mass of 5807 Da
represents the wild
type G-allele (wt) at
nucleotide position
F5 (1691), while the
molecular mass of
5478 Da indicates
the Leiden allele F5
(G1691A).
AGTTCAACCAGGGGAAACCT and
TCTGAAAGGTTACTTCAAGGACA
A, MWG Biotech, Germany), 50 ng of
genomic DNA template, 1 U PAN Taq
Polymerase in supplied NH 4+-buffer
(PAN, Germany) supplemented by
1.5 mM MgCl 2, and 2 nmol of
each dNTP . The PCR reaction
was performed in 96-well plates
(TubePlates, Biozym, Germany)reaction mass
in a thermocycler (TGradient,
Biometra, Germany). Thermal cycling
conditions were 96°C for 2 min, 35
cycles at 96°C for 60 s, 55°C for 30
s, and a fi nal extension step at 72°C
for 3 min.
Purifi cation of PCR products
PCR products were automatically
purifi ed using the genopure ds
magnetic bead DNA purifi cation kit
(Bruker Daltonics) according to the
manufacturer‘s instructions on the
mapII/pure robotic platform (Bruker
Daltonics) in a 96-well format at
room temperature. In detail, PCR
amplifi ed DNA (10 µl) was bound
to magnetic particles (2 µl) in an
appropriate binding buffer (13 µl) for 10 min. Following magnetic separation to collect particle bound PCR fragments, the supernatant was removed automatically. The particles were washed three times with wash buffer 1 (50 µl) and twice with wash buffer 2 (50 µl) containing
isopropanol and ethanol, respectively.
Washing was performed in cycles
of addition of buffer, magnetic
fl oating of the particles through the
buffer (20x), magnetic separation
and removal of supernatant. After
drying, double stranded DNA was
eluted directly with water or primer
extension mix (10 µl), respectively.Gel electrophoresis
PCR products were separated elec-trophoretically on agarose gels (1.5% (w/v)) in TBE buffer supplemented with 1.27 mM ethidiumbromide for 60 min at 140 V . Separated DNAs were visualized by UV light and photographed.
Primer extension reaction
Purifi ed PCR products were used for the primer extension reaction after automated addition of extensi
on mix (10 µl) to dried magnetic particles, containing 12 pmol extension primer
a)
b)
Sample A
FV: Homozygous WT Allele
Sample B
FV: Homozygous Leiden Allele
Sample C
FV: Heterozygous Leiden Allele
Fig. 4: Applications of the mapII/pure platform for DNA analysis
(F5: CAGATCCCTGGACAGGC), 1-3 U Thermo-sequenase, Thermo-sequenase reaction buffer (Pharmacia,
Germany), 2 nmol dGTP , 2 nmol
ddATP . Extension reactions were
performed at 96°C for 2 min, and 40
cycles at 96°C for 30 s, 52°C for 30 s
and fi nally 72°C for 3 min. The design
of the F5 genotyping assay including
molecular masses of the primer and extension products is given in Figure 2a.Purifi cation of extension products Following allele specifi c extension of primers, products were purifi ed automatically using the genopure oligo magnetic bead DNA purifi cation kit (Bruker Daltonics)  on the mapII/pure robotic platform. After binding of single stranded DNA to magnetic particles (2.5 µl) in the appropriate buffer (27.5 µl) for 10 min, particle bound oligonucleotides were separated magnetically. Particles were wash
ed automatically with wash buffer 1 (5x, 50 µl) and wash buffer 2 (2x, 50 µl) in cycles of addition of buffer, magnetic fl oating of the particles through the buffer (20x), magnetic separation and removal of supernatant. Following drying, purifi ed oligonucleotides were eluted with 5 µl elution buffer.MALDI-TOF MS analysis
Aliquots of the purifi ed samples (0.5 µl) were spotted onto matrix crystals generated by drying 0.5 µl matrix solution containing 3-hydroxypicolinic acid (50 mg/ml) and dibasic ammonium citrate (2 mg/ml) in water on a stainless steel target. Following air drying the target was
introduced into the source region of a BIFLEX III MALDI-TOF mass
spectrometer (Bruker Daltonics)
equipped with a nitrogen laser (λ =
337 nm) and pulsed ion extraction.
Laser-desorbed positive ions were
analyzed in the linear mode with 20
kV and 17.4 kV on the conversion
electrode and the sample target,
respectively. External calibration
was performed using a standard
oligonucleotide mixture with
known molecular masses. Usually,
30 individual spectra were added up to produce a mass spectrum.
DNA sequencing
The cycle sequencing reactions were carried out using the ABI PRISM Dye Terminator Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer‘s protocol. For each sequencing reaction, 9 µl of the fi nal cycle sequencing mix supplemented with the 5 pmol sequencing primer (AGTTCAACCAGGGGAAACCT) was added to 1 µl of the purifi ed PCR product eluted in 5 µl water. S
equencing reactions were performed by 25 cycles (96°C for 30 s, 50°C for 15 s, and 55°C for 1 min). Sequencing reactions were purifi ed using the genopure oligo magnetic bead DNA purifi cation system on the mapII/pure (see above). Finally, DNA-sequence analysis was performed with 1 µl eluate on an Automatic DNA Sequencer model 377A (ABI - Perkin Elmer).
Results
The factor V Leiden allelic variant consists of a G to A nucleotide exchange (G1691A) situated in exon 10 of F5. For genotyping, F5 exon
10 was PCR amplifi ed from genomic
DNA in 96-well plates. Following PCR reaction, the generated amplimers
of 219 bp were purifi ed using the diescribed automated method. In order to control the PCR reaction
and effi ciency of the automated
purifi cation, a gel-electrophoretic
analysis was performed (Figure 1).
Compared to the unpurifi ed PCR
reactions  (lane 1-2), the purifi ed
219 bp PCR fragments (lanes 3-8)
were reproducibly detectable with an
excellent yield.
Following automated PCR-puri-fi cation for MALDI-TOF MS based
F5 genotyping, primer extension
mix was added automatically to the
dried magnetic particle bound PCR
fragments to elute the amplimers
in the complete solution for the
extension reaction. The allele specifi c
primer extension mix contained the
extension primer, dGTP , ddATP , and
a thermostable DNA polymerase in
an appropriate buffer (Figure 2a).
The 96-well plates were transferred
into a thermocycler and primer ex-tension reactions were performed in
presence of the magnetic particles. Extension products were purifi ed
automatically and eluted in MALDI-TOF MS compatible buffer. Following co-crystallization of purifi ed extension products with the matrix, genotypes were determined by MALDI-TOF MS. The forward extension primer used for the determination of nucleotide position 1691 had a
© 2002 Bruker Daltonics
For more information, please visit
our worldwide web sites on the internet, call your local Bruker
sales representative, or contact us at one of our application centers.
www.bdal.de    www.bdal
Bruker Daltonik  GmbH Bremen · Germany
Phone  +49 (421) 2205-0Fax        +49 (421) 2205-103E-Mail      sales@bdal.de
Bruker Daltonik  GmbH Leipzig · Germany
Phone  +49 (341) 2431-30Fax        +49 (341) 2431-404E-Mail    sales@bdal.de
Bruker Daltonics  Inc.Billerica, MA · USA
Phone +1 (978) 663-3660Fax      +1 (978) 667-5993E-Mail  ms-sales@bdal
theoretical molecular mass of 5181 Da. It was designated to anneal to the target DNA directly adjacent to the polymorphic side. In case of the wild type sequence, a dGTP was incorporated while the following ddATP was expected to terminate the primer extension reaction yielding an extended primer of 5807 Da. On the other hand, when the allelic G to A exchange was present, the primer was terminated directly by a ddATP , resulting in a mass of 5478 Da (Figure 2a). As shown in Figure 2b, the
homozygous F5 wild type (sample A), the homozygous F5 Leiden (G1691A)
(sample B), and the heterozygous
genotypes (sample C) were detectable
with excellent molecular resolution,
signal-to-noise ratios and minimized
sodium/potassium adducts. Hence
the described automated sample purifi cation method using magnetic particles offers a highly reliable tool for automated MALDI-TOF MS based genotyping with prospects for high throughput.To confi rm MALDI-TOF MS-based
genotyping results, the generated
F5 PCR-fragments were sequenced:
Following automated addition of the
cycle sequencing mix supplemented with the sequencing primer to the genopure ds purifi ed and dried, magnetic particle bound PCR frag-ments, the cycle sequencing reaction
was performed in a thermocycler.
Reaction products were again
purifi ed  automatically and eluted in
water. Finally, the sequences of the
PCR products were analyzed on an
automated DNA sequencer (Figure
3). The DNA sequences of the PCR
fragments were determined with
good signal-to-noise ratios (Figure 3a, wild type sequence). All MALDI-TOF MS-based genotyping results were confi rmed by DNA sequencing, as shown in Figure 3b for the
homozygous F5 wild type (sample A), the homozygous F5 Leiden (G1691A)
(sample B), and the heterozygous
genotypes (sample C). These results
show that the automated genopure
ds  and genopure oligo magnetic bead
system is a suitable purifi cation tool for DNA analysis (Figure 4).Conclusions
• Purifi cation of the PCR reactions by automated genopure ds magnetic bead system on a mapII/pure robotic platform using 96-well plates resulted in a high template quality for following primer
extension and cycle sequencing
reactions.
• The automated genopure oligo
magnetic bead system on the
mapII/pure robot ensured excellent
oligonucleotide purifi cation in 96-well plates for MALDI-TOF-MS based genotyping as well as DNA-sequencing.• Semi-automated sample prepa-ration using the mapII/pure
platform in combination with a
stand-alone thermocycler allows an enhanced sample throughput.• Genotyping of thrombotic risk allele
F5 G1691A can be determined
by combining PCR, allele specifi c
primer extension reactions and
subsequent MALDI-TOF-MS analysis.• MALDI-TOF-MS genotyping has shown to be a fast and reliable
technical approach especially in heterozygous situations.Acknowledgements We thank Dr. Alexander Berkholz
and Prof. Dr. Ludwig Wildt
(Klinik für Frauenheilkunde,
Universität Erlangen-Nürnberg) for
providing genomic DNA samples.
References
[1] Bertina R.M., Koeleman B.P .,
Koster T. et al., Mutation in
blood coagulation factor V
associated with resistance to
activated protein C. Nature 1994;
369: 64-7.
[2] Page M.J., Factor V Leiden
mutation: a nursing perspective. J
Vasc Nurs 1998; 16: 73-7.[3] Rees D.C., Cox M., Clegg J.B.,
World distribution of factor V
Leiden. Lancet 1995; 346: 1133-4.
[4] Ridker P .M., Miletich J.P .,
Hennekens C.H., Buring J.E.,
Ethnic distribution of factor
V Leiden in 4047 men and
women. Implications for venous  thromboembolism screening. Jama
1997; 277: 1305-7.
[5] Humeny A., Bonk T., Berkholz  A.,Wildt L., Becker C.-M., Geno-  typing of thrombotic risk factors by  MALDI-TOF mass spectrometry.  Clin Biochem. 2001 in press.[6] Bonk T., Humeny A., MALDI-TOF-
MS analysis of protein and DNA.
Neuro-scientist 2001; 7: 6-12.
Authors:
Andreas Humeny 1, Dirk Peters 2,
Claudia Sass 1, Petra Wenzeler 1,  Cord-Michael Becker 11
Institut für Biochemie, Emil-Fischer-Zentrum, Universität Erlangen-Nürnberg, D-91054 Erlangen 2
Bruker Daltonik GmbH

版权声明：本站内容均来自互联网，仅供演示用，请勿用于商业和其他非法用途。如果侵犯了您的权益请与我们联系QQ:729038198，我们将在24小时内删除。